jueves, 19 de diciembre de 2013

ADN, probabilidades y ancestros...


 
Según la teoría de la evolución de Darwin el hombre tal y como lo conocemos hoy desciende de alguna raza de primates africanos. Otras teorías hablan de razas reptiloides que evolucionaron en los humanos actuales e incluso de que nuestros primeros representantes en la tierra son de origen extraterrestre (otras un poco más descabelladas hablan de que un ser superior nos creó del barro en un jardín paradisíaco). Sea cual sea la teoría que crean existen elementos biológicos que son innegables. Uno de ellos es el ADN.

Ácido desoxirribonucleico (ADN) es una molécula que está en todas las células y contiene la información genética que controla todos los procesos vitales de los seres vivos. Es el componente químico primario de los cromosomas y el material del que los genes están formados. Tu estatura, color de piel, forma del cuerpo, tipo de voz, color de ojos, tamaño de pies y manos, todo estaba dispuesto en tu ADN desde que comenzaste a formarte. Este ADN es como si cada uno tuviese un alfabeto que posee sólo 4 letras: A, T, C y G (que son las iniciales de Adenina, Timina, Citosina y Guanina) ordenados en una doble espiral donde cada una de las "tiras" tiene escrita largas cadenas de estas 4 letras con la particularidad de que si en una de las tiras, en un lugar determinado hay una letra A, entonces en el lugar correspondiente de la otra tiene que haber una T, y si hay una C, entonces en la otra tiene que haber una G.

Alrededor del año 2003, se dio término a un proyecto llamado "Proyecto genoma humano" (HGP según su sigla en inglés) cuyo objetivo era identificar y estudiar los, aproximadamente, entre 20.000 y 25.000 genes del genoma humano y determinar las secuencias de las poco más de 3 mil millones bases nitrogenadas que tenemos (para serles franco no entendí mucho esta parte pero queda claro que se estudiaron en detalles estos genes). Una vez que se identificaron nuestros genomas comenzó la carrera por determinar y conocer quienes fueron nuestros antepasados,es decir, con quienes compartimos genes.

Los científicos (matemáticos y biólogos) que hicieron este estudio descubrieron una porción de ADN muy particular:

TTTAATTGAAAGAAGTTAATTGAATGAAAATGATCAACTAAG

 Es como una palabra de 42 letras. ¿Pero que tiene de especial esta secuencia de 42 bases?
Precisamente, después de un arduo trabajo matemático y computacional de "alineación" de las secuencias, ésta tira se encontró en el ADN de los siguientes vertebrados hasta ahora: Hombre, chimpancé, ratón, rata, perro, pollo, rana, pez cebra, pez fugu y tetraodón (que es un tipo de pez).

Ya ¿y?
Ahora aparece la matemática. La probabilidad de que esto ocurra (que esta misma secuencia aparezca en el ADN por azar) es, según a un modelo de evolución de Jukes-Cantor,  de una en 10^50 posibilidades, es decir, aproximadamente:

0,000000000000000000000000000000000000000000000001%

¿Qué conclusión podemos sacar de esto?
Este es un primo que vive en
europa.
La respuesta es bien increíble. El hecho de que la probabilidad de que los vertebrados mencionados tengan una parte de la secuencia genética idéntica es tan baja es que podemos concluir que por lo menos, estos 10 mencionados, incluyéndonos, tenemos un antepasado común que nos heredó esa secuencia. 

Si, somos familiares de perros, ranas, peces, pollos, ratones y por supuesto, chimpancés.  





Abrazos.

Inspiración: Libro Matemática ¿Estás ahí? de Adrián Paenza.








miércoles, 16 de octubre de 2013

Nebulosas: fábricas de estrellas.

Nebulosa de la Hélice con
el famoso "Ojo de Dios"
Una nebulosa es, según la RAE, una materia cósmica celeste, luminosa, compuesta de polvo y gas, que ofrece diversas formas, en general de contornos imprecisos.
Efectivamente la RAE no está lejos de lo que un astrónomo diría de una nebulosa. Pero ¿qué hace tan atractivas a las nebulosas? Claramente son su increíbles y hermosas formas que, gracias a potentes telescopios espaciales, cada vez hemos podido disfrutar de su esplendor.
Existen varias de ellas que se pueden observar a simple vista (obviamente en un lugar con poca contaminación lumínica) pero en general necesitamos de telescopios relativamente potentes para disfrutarlas de mejor manera.
Para entender un poco más qué es una nebulosa, podemos decir que es una concentración de polvo espacial y gas (helio e hidrógeno principalmente) que pudo haber nacido como consecuencia de la extinción de una estrella y son de gran importancia debido a que pueden provocar el nacimiento de nuevas estrellas (de ahí el título del post).

Existen tres tipos de nebulosas:

sábado, 21 de septiembre de 2013

¿Cómo se forma un arco iris?

Hace mucho tiempo que un alumno me hizo ésta pregunta y trataré ahora (más vale tarde que nunca) de responderla.
espectro electromagnético
El fenómeno atmosférico conocido como arco iris es un hermoso espectáculo que podemos visualizar por lo general cuando se asoma el sol entre las nubes después o durante una lluvia y también se manifiesta cuándo regamos y le damos la espalda al sol. La pregunta es: ¿Cómo es que se forma este fenómeno?
Para comenzar tenemos que entender primero que es el "espectro electromagnético".
La luz es una forma de Radiación Electromagnética, al igual que otras tales como las ondas de radio, las micro ondas, la los rayos infrarrojos, los rayos ultravioletas, los rayos x y los rayos gamma. Todos juntos forman el llamado "espectro electromagnético".
Según los niveles de energía de estas secciones es su comportamiento, por ejemplo, las ondas de radio tienen un nivel de energía bajo, esto significa que tienen poca frecuencia y su longitud de onda es más larga, siendo perfectas para transmitir señales a larga distancia, a diferencia de los rayos gamma, que poseen una alta frecuencia y menor longitud de onda que los hace especiales para tratamientos médicos tales como la

miércoles, 28 de agosto de 2013

Una tienda misteriosa...

Encontré este problema por ahí y dice así, a ver como les va:

El otro día fui a una tienda y pregunte:

-¿Cuánto cuesta cien?
- 4.000 pesos me dijo el vendedor.
-¿y tres?
- 4.000 pesos también señor.
-¿y si llevo trece?
- 5.000 pesos me respondió con amabilidad.
-Bien, deme quince
-Como no, son 6.000 pesos


¿Qué es lo que venden en esta tienda? Ojo, la imagen es solo referencial y no aporta pista alguna a la resolución del problema.

No se si les pasó a ustedes, pero leí la voz del vendedor como la de Don Genaro de "Los 80".

Saludos.

martes, 30 de julio de 2013

Un juego de números...

Ya conocen ustedes mi gusto por los juegos que desarrollan el pensamiento lógico (más aún si está relacionado con matemática) y éste que les presentaré cumple a cabalidad con esta condición. Su nombre... "A game of numbers" (Un juego de números).


Se trata simplemente de que el número protagonista, utilizando las flechas del cursor, debe lograr llegar a la

viernes, 26 de julio de 2013

Ese pequeño punto azul pálido...

En 1990 la sonda espacil Voyager I, lanzada al espacio en septiembre de 1977 fotografiaba La Tierra desde 6.000 millones de kilómetros de distancia (algo más lejano de la órbita de Plutón) obteniendo la siguiente impactante imagen:
La Tierra es el pequeño punto que está encerrado por la circunferencia azul sobre un haz de luz que no es más que un efecto óptico de la cámara de la sonda. 
Carl Sagan, astrónomo, escritor y divulgador de ciencias estadounidense escribió en su libro "Un punto azul pálido: una visión del futuro humano en el espacio" lo que ésta imagen le hizo sentir, texto que quiero compartir con ustedes:

viernes, 12 de julio de 2013

Cero...


"En un mundo que juzga a la gente por su número, Cero se enfrenta a un prejuicio
 y una persecución constante. Él anda un camino de soledad,
hasta un encuentro, por casualidad, cambia su vida para siempre.
Él conoce a una mujer Cero. Juntos, demuestran a través de la determinación,
del coraje y del amor, que nada puede ser

lunes, 8 de julio de 2013

Analizando la estupidez humana...matemáticamente.

En los años 70, Carlo Maria Cipolla, historiador económico italiano, realizó un ensayo donde analizaba el concepto de la estupidez humana como beneficio para la sociedad. Primero que todo vamos a definir el concepto de "persona estúpida" que según el ensayo de Cipolla es:

"Persona que causa algún daño a otra persona o grupo de personas sin obtener, al mismo tiempo, un provecho para sí, o incluso, obteniendo un perjuicio"

Nuestras acciones diarias pueden o no entregarnos beneficios, situación muy difícil de "cuantificar", es decir, de representarla a través de un número, pero si podríamos ordenar nuestros beneficios en una recta donde los ordenamos desde el más perjudicial a la izquierda, al que nos otorga mayores créditos a la derecha. Sería algo como ésto:

Lo interesante de ésto es analizar la relación que puede haber entre dos individuos. Para ser más específicos, el análisis será entre "mis acciones" y las "acciones de otro" que se pueden ordenar en el siguiente plano cartesiano donde se distinguen cuatro sectores o "cuadrantes":

sábado, 22 de junio de 2013

Doblando papel...

No. No se trata de origami, sino que simplemente de una pregunta y su desarrollo la cual se presenta a continuación:

"Si tenemos un papel de 0,01 milímetros de espesor (esto es la centésima parte de un milímetro, es decir, un milímetro dividido en 100 partes iguales) y lo doblamos por la mitad sucesivamente 54 veces. ¿Cuál es el grosor total del papel doblado?"

Antes de seguir leyendo, me gustaría que intentaras resolver el problema o simplemente imaginarte la situación ¿Cuáles crees que es la respuesta?¿Un metro?¿100 metros?

Primero que todo cabe destacar que doblar un papel 54 veces en la vida real no es posible (por lo menos hasta ahora). Los que lo han intentado no han podido

martes, 18 de junio de 2013

El nombre de las notas musicales...

Extracto del libro "La armonía es numérica" de Javier Arbonés y Pablo Milrud.

Los griegos nombraban las notas musicales siguiendo las primeras notas del alfabeto jónico, asignando letras diferentes para un mismo sonido alterado en medio tono o doblemente ascendido. Por ejemplo, si el fa era alfa, beta era fa sostenido, y gamma, fa doblemente sostenido. Para ellos la escala se organizaba de manera descendente, al revés de como se considera hoy. También los romanos utilizaban las primeras letras del alfabeto para nombrar los sonidos de su escala.
Mano guidoniana de Guido d'Arezzo
Boecio, un estudioso que escribió en el siglo V un tratado en cinco volúmenes sobre teoría de la música, consideró una escala de quince notas que abarcaba dos octavas. Boecio designó cada una de esas notas con una letra diferente, ignorando el concepto cíclico de octavas. El paso siguiente en la historia del nombre de las notas fue, justamente, abrazar dicho concepto cíclico y designar con una misma letra las notas iguales de octavas distintas. Así, la denominada nomenclatura alemana o inglesa designaba las siete notas de la octava principal con letras de la A a la G, en mayúscula, la siguiente octava, de la "a" a la "g", con minúsculas, y la tercera, con dobles letras minúsculas (aa, bb, cc, dd, ee, ff, gg). Así, siete de los doce sonidos, los correspondientes a las teclas blancas del piano, adquirieron nombre propio. Los otros cinco sonidos (las teclas negras) fueron

martes, 11 de junio de 2013

Premios Darwin... mejorando la raza...

Darwin es conocido a nivel mundial por su teoría de la evolución, que trata la idea de que los animales van mejorando, según sus necesidades naturales, su línea genética a través de mutaciones, eliminando de forma natural aquellos individuos que no poseen la mutación. "Mejorar la raza" diría mi padre.
Con esta idea de fondo es que a nivel mundial y cada año se celebra la entrega de Los Premios Darwin, que se entrega (en general de manera póstuma, es decir, después de su muerte) a los individuo cuya "estupidez" provocó su muerte. También existe el premio honorífico que se entrega a aquellos que

domingo, 9 de junio de 2013

Simetría y aritmética en perfecta armonía...

Observen las siguientes igualdades y solo disfrútenlas:

$$ 1\cdot8+1=9\\
12\cdot8+2=98\\
123\cdot8+3=987\\
1.234\cdot8+4=9.876\\
12.345\cdot8+5=98.765\\
123.456\cdot8+6=987.654\\
1.234.567\cdot8+7=9.876.543\\
12.345.678\cdot8+8=98.765.432\\
123.456.789\cdot8+9=987.654.321$$

miércoles, 5 de junio de 2013

Sin levantar el lápiz...

De niños siempre se ha jugado el típico desafío de realizar un determinado dibujo "sin levantar el lápiz y sin pasar dos veces por la misma línea". El clásico de clásicos sin duda es:
fig1

Cuya solución es muy conocida por todos, si no la conoces intenta hacerla antes de seguir leyendo el post.
Hace un par de semanas una alumna de mi colegio me desafió con uno de estos dibujos y la verdad es que

jueves, 30 de mayo de 2013

Demostrando lo imposible...

Todos sabemos que
 $$-20=-20$$
que escribiendo de manera conveniente resulta igual a:
 $$16-36=25-45$$
Sumando $$\frac{81}{4}$$ en ambos lados de la igualdad de obtiene:

jueves, 23 de mayo de 2013

El Hombre que Calculaba y el reparto de camellos...


Hoy, haciendo clases en primero medio, hablábamos de la importancia del pueblo árabe en el desarrollo del Álgebra, tanto así que a nivel mundial utilizamos la escritura numérica que ellos crearon.
Durante la tarde me quedó dando vueltas el tema en la cabeza y recordé un hermoso libro que tengo llamado "El Hombre que Calculaba" de Malba Tahan, que trata de un hombre, Beremiz Samir, cuya capacidad lógica y matemática destacaba por el resto de sus pares logrando resolver grandes dilemas y necesidades que aquejaban a su alrededor. Sin duda es un libro de lectura obligatoria para todos los amantes de la matemática.
Quiero compartir aquí, el capítulo III de esta aventura llamado:

sábado, 20 de abril de 2013

Pentatonix y la evolución de la música

No requiere mucha presentación, sólo denle play y a disfrutar.
























Abrazos...
Pd: Se me ocurrió un juego. Identifiquemos todas las canciones (indicando título, autor, artista y el minuto exacto que aparece) que este fantástico quinteto canta. Suerte.

martes, 9 de abril de 2013

La década de pitágoras

Éstas son las propiedades cabalísticas y virtudes mágicas que los pitagóricos les daban a los diez primeros números en la llamada Década o Tetractys de Pitágoras.

Número 1
Mónada (unidad), generador de todo. Demiurgo. Símbolo de la razón suprema, paradigma del bien y la belleza. El punto sin dimensiones.

Número 2
Diada (diversidad, opinión, contraposición, dualidad) Origen del bien y del mal. Causa de la generación y, por tanto, principio femenino y del perpetuo fluir de las cosas. Dos puntos determinan la línea con una dimensión.

Número 3
Triada (armonía = unidad + diversidad, 1+2=3). Símbolo del tiempo o trinidad que encierra el pasado, el presente y el futuro. Principio masculino. Tres puntos determinan un plano con dos dimensiones.

Número 4
Ley universal e inexorable. Símbolo de la justicia y la retribución (4 = 2 + 2 = 2 * 2). Cuatro son las facultades del hombre (inteligencia, conocimiento, opinión y sensación). Cuatro son las virtudes (prudencia, fortaleza, templanza y justicia). Cuatro son las partes de la matemática (aritmética, geometría, astronomía y música) Primer número con naturaleza de sólido: cuatro puntos determinan un tetraedro con tres dimensiones.

Número 5
Símbolo del matrimonio (2 + 3 = 5) y del pentagrama místico (estrella de cinco puntas). Símbolo de identificación de los pitagóricos. Menor número cuyo cuadrado es suma de cuadrados. Simboliza los 5 sólidos regulares (tetraedro, octaedro, cubo, dodecaedro e icosaedro)

Número 6
Símbolo de la procreación ({2 + 3}+1 = 6). Área del triángulo divino (3, 4, 5). Primer número perfecto (sus factores propios sumados producen 6).

Número 7
Símbolo de la virginidad (porque no engendra ni es engendrado por ningún otro número de la década) de la voz (porque siete son las notas musicales) y del arco iris o luz. Representación de las estrellas errantes (los cinco planetas que se conocían, el Sol y la Luna) que dan nombre a los siete días de la semana. Siete fueron las maravillas del mundo y siete, los sabios griegos.



Número 8
Símbolo de la amistad y la reflexión. Es el primer número cubo. Símbolo de la plenitud por ser suma de dos cuadrados.

Número 9
Símbolo del amor y la gestación (dura nueve meses). Identificado con el dios del mar, Okeanos, por limitar con el sagrado número 10.

Número 10
Símbolo de Dios y el universo, emblema supremo, suma de las dimensiones geométricas (10 = 1 + 2 + 3 + 4), fundamento de todo. Anagrama místico del juramento pitagórico. Quizás esto explica que, en algunos idiomas, diez y Dios tienen similitud fonética.

Extraído del libro "Paseo del universo de los números" de Carlos Sánchez y Rita Roldán

Abrazos.


                             









miércoles, 27 de febrero de 2013

miércoles, 20 de febrero de 2013

Rocas en el espacio ¿Cómo se llaman?

De moda están las rocas espaciales gracias a distintos fenómenos ocurridos estas últimas semanas en nuestro planeta. Ya sea por el 2012 DA14, famoso por ser una roca espacial de unos 50m de diámetro aproximadamente y que pasó muy muy cerca de la tierra (unos 27.000 kilómetros), como la roca que cayó es Rusia dejándonos imágenes y videos espectaculares como éste:



Lo que quiero en este post es simplemente aclarar las diferencias entre las distintas rocas que circulan por el espacio:

Cometa: Trozo de hielo, polvo y roca que orbita alrededor del sol, en general de manera elíptica y con trayectorias que cruzan las fronteras del sistema solar. Se caracterizan por su estela (o cola) formada por polvo y gas que se acentúa conforme se acerca al sol. El cometa más conocido es el Cometa Halley cuya órbita la completa cada 76 años aproximadamente y podrá ser visto desde nuestro planeta próximamente el año 2061.

Asteroide: Cuerpo rocoso, carbonáceo o metálico más pequeño que un planeta cuya órbita es menor que la que orbita Neptuno. La mayoría de ellos tienen su movimiento de traslación alrededor del sol en el famoso cinturón de asteroides situado entre Marte y Júpiter. Los peligrosos para nosotros son los llamados NEA, ya que pasan cerca de la tierra, y son miles.
Meteoroide: Cuerpo menor del sistema solar formado por fragmentos de cometas y asteroides, aunque también pueden ser rocas eyectadas de grandes impactos de satélites o planetas. Su tamaño debe ser mayor que un grano de arena y menor que un asteroide (50m como diámetro máximo aproximadamente). Su órbita es prácticamente imposible de detectar para nuestra tecnología por lo que en cualquier momento pueden ingresar a nuestra atmósfera sorpresivamente.

Meteoro: Más conocido como "estrella fugaz" corresponde al momento en que un meteoroide es atraído por la gravedad terrestre e ingresa a nuestra atmósfera (o a la de cualquier planeta que la tenga), donde al hacerlo, éste se calienta y se vaporiza parcial o completamente. El gas que queda en la trayectoria del meteoroide se ioniza y brilla. Técnicamente el meteoro es el fenómeno luminoso y no a la roca en sí.
Meteorito: Corresponde a un meteoroide que alcanza la superficie de un planeta debido a que no se desintegra absolutamente en su paso por la atmósfera. En general, un meteorito es una roca en cualquier superficie de un cuerpo celeste que viene de otro lugar del espacio. Existen muchos encontrados en la tierra y muy probablemente seguirán cayendo. En el último fenómeno ocurrido en Rusia, se encontraron alrededor de 50 fragmentos de meteorito, que actualmente siguen estudiando.

Ahora que ya conocen los nombres sólo nos queda disfrutar los maravillosos espectáculos visuales que nos dejan cuando pasan o caen, o si no, disfrutar de nuestra familia si es que son muy grandes ya que simplemente no podremos hacer nada, jejeje. Pero no preocuparse tanto ya que los objetos más grandes o peligrosos ya están identificados y los monitorean constantemente, además de que las distancias espaciales son tan gigantes (recordemos uno de mis primeros post Magnitudes espaciales 1 y 2) que las probabilidades de que un importante objeto espacial nos choque son muy bajas.

Abrazos.

miércoles, 23 de enero de 2013

La frese del día...

"La vida es muy peligrosa. No por las personas que hacen el mal, sino por las que se sientan a ver lo que pasa"

Albert Einstein.